After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Ratón CES2/Carboxylesterase 2 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CES2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_145603.1
Tamaño de cDNA:1686bp
Descripción de cDNA:Full length Clone DNA of Mus musculus carboxylesterase 2 with C terminal HA tag.
Sinónimo de gen:ces2A3, Ces2
Especie:Mouse
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón CES2/Carboxylesterase 2 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Product nameProduct name
Fondo

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

Referencias
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Size / Price
    Catálogo: MG50515-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"