After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CKB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_021273.4
Tamaño de cDNA:1146bp
Descripción de cDNA:Full length Clone DNA of Mus musculus creatine kinase, brain.
Sinónimo de gen:Bck, Ck3, B-CK, Ck-3, Ckbb
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51386-ACG$225
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51386-ACR$225
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51386-ANG$225
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51386-ANR$225
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51386-CF$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51386-CH$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51386-CM$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51386-CY$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51386-NF$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51386-NH$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51386-NM$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51386-NY$195
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(Vector de expresión)MG51386-U$75
Ratón CKB / Creatine kinase B type clonación del ADN o clonación génica(vector de clonación)MG51386-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Referencias
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Catálogo: MG51386-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"