After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CKM Información de producto de clon de cDNA
Gene_bank_ref_id:X03233.1
Tamaño de cDNA:1146bp
Descripción de cDNA:Full length Clone DNA of Mus musculus creatine kinase, muscle.
Sinónimo de gen:MCK, Ckmm, M-CK
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51356-ACG$225
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51356-ACR$225
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51356-ANG$225
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51356-ANR$225
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51356-CF$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51356-CH$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51356-CM$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51356-CY$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(Vector de expresión)MG51356-G$75
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51356-NF$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51356-NH$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51356-NM$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51356-NY$195
Ratón CKM / CK-MM clonación del ADN o clonación génica(vector de clonación)MG51356-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

Referencias
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Catálogo: MG51356-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"