Pedido rápido

Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón COX7A2L Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_009187.3
    Tamaño de cDNA:336bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit VIIa polypeptide 2-like.
    Sinónimo de gen:EB1, SIG81, COX7AR, COX7RP, SIG-81, Silg81
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COX7A2L qPCR primers for gene expression analysis, MP201226 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación) on other vectors
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51349-ACG$225
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51349-ACR$225
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51349-ANG$225
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51349-ANR$225
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51349-CF$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51349-CH$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51349-CM$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51349-CY$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51349-NF$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51349-NH$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51349-NM$195
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51349-NY$195
    Ratón COX7A2L clonación del ADN o clonación génica(Vector de expresión)MG51349-U$75
    Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación)MG51349-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51349-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"