After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse COX7A2L Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009187.3
Tamaño de cDNA:336bp
Descripción de cDNA:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit VIIa polypeptide 2-like.
Sinónimo de gen:EB1, SIG81, COX7AR, COX7RP, SIG-81, Silg81
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51349-ACG$225
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51349-ACR$225
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51349-ANG$225
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51349-ANR$225
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51349-CF$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51349-CH$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51349-CM$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51349-CY$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51349-NF$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51349-NH$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51349-NM$195
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51349-NY$195
Ratón COX7A2L clonación del ADN o clonación génica(Vector de expresión)MG51349-U$75
Ratón COX7A2L clonación del ADN o clonación génica(vector de clonación)MG51349-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51349-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"