Pedido rápido

Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CPA1 Información de producto de clon de cDNA
Tamaño de cDNA:1260bp
Descripción de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
Sinónimo de gen:Cpa, 0910001L12Rik, Cpa1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50448-ACG$225
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50448-ACR$225
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50448-CF$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50448-CH$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50448-CM$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50448-CY$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(Vector de expresión)MG50448-M$75
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50448-NF$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50448-NH$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50448-NM$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50448-NY$195
Ratón Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación)MG50448-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Catálogo: MG50448-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.