Pedido rápido

Text Size:AAA

Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CPB1 Información de producto de clon de cDNA
Tamaño de cDNA:1248bp
Descripción de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase B1 (tissue) with C terminal Myc tag.
Sinónimo de gen:AI504870, 0910001A18Rik, 1810063F02Rik, 2210008M23Rik, Cpb1
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50386-ACG$225
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50386-ACR$225
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50386-CF$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50386-CH$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50386-CM$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50386-CY$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(Vector de expresión)MG50386-M$75
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50386-NF$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50386-NH$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50386-NM$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50386-NY$195
Ratón Carboxypeptidase B1/CPB1 clonación del ADN o clonación génica(vector de clonación)MG50386-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Human Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catálogo: MG50386-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.