Pedido rápido

Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón CPE Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_013494.3
    Tamaño de cDNA:1431bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase E with N terminal HA tag.
    Sinónimo de gen:CPH; fat; Cph1; Cph-1; R74677
    Especie:Mouse
    Vector:pCMV3-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPE qPCR primers for gene expression analysis, MP201013 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51055-ACG$225
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51055-ACR$225
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51055-ANG$225
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51055-ANR$225
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51055-CF$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51055-CH$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51055-CM$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51055-CY$195
    Mouse CPE Gene cDNA clone plasmidMG51055-G$75
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51055-NF$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51055-NH$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51055-NM$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51055-NY$195
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(Vector de expresión)MG51055-U$75
    Ratón Carboxypeptidase E/CPE clonación del ADN o clonación génica(vector de clonación)MG51055-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

    Referencias
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Size / Price
    Catálogo: MG51055-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"