Carboxypeptidase E cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51055-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Carboxypeptidase E Reagents

CRO Services

Product recommended


All Carboxypeptidase E Reagents

Carboxypeptidase E cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Description
Full length Clone DNA of Mouse carboxypeptidase E with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase E cDNA ORF Clone, Mouse, N-HA tag Alternative Names

CPH cDNA ORF Clone, Mouse;Cph-1 cDNA ORF Clone, Mouse;Cph1 cDNA ORF Clone, Mouse;fat cDNA ORF Clone, Mouse;R74677 cDNA ORF Clone, Mouse

Carboxypeptidase E Background Information

Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

Full Name
carboxypeptidase E
References
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Carboxypeptidase E cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase E cDNA ORF Clone in Cloning Vector, Mouse MG51055-U
    Carboxypeptidase E cDNA ORF Clone, Mouse, untagged MG51055-UT
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51055-ACG
    Carboxypeptidase E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51055-ACGLN
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51055-ANG
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51055-ACR
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51055-ANR
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51055-CF
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51055-NF
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-His tag MG51055-CH
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-His tag MG51055-NH
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-HA tag MG51055-CY
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-Myc tag MG51055-CM
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-Myc tag MG51055-NM
    Carboxypeptidase E qPCR Primer Pairs, Mouse MP201013

    Carboxypeptidase E cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase E cDNA ORF Clone in Cloning Vector, Human HG10069-M
    Carboxypeptidase E cDNA ORF Clone, Human, untagged HG10069-UT
    Carboxypeptidase E cDNA ORF Clone, Human, C-GFPSpark® tag HG10069-ACG
    Carboxypeptidase E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10069-ACGLN
    Carboxypeptidase E cDNA ORF Clone, Human, C-OFPSpark® tag HG10069-ACR
    Carboxypeptidase E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10069-CF
    Carboxypeptidase E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10069-NF
    Carboxypeptidase E cDNA ORF Clone, Human, C-His tag HG10069-CH
    Carboxypeptidase E cDNA ORF Clone, Human, N-His tag HG10069-NH
    Carboxypeptidase E cDNA ORF Clone, Human, C-HA tag HG10069-CY
    Carboxypeptidase E cDNA ORF Clone, Human, N-HA tag HG10069-NY
    Carboxypeptidase E cDNA ORF Clone, Human, C-Myc tag HG10069-CM
    Carboxypeptidase E cDNA ORF Clone, Human, N-Myc tag HG10069-NM
    Carboxypeptidase E qPCR Primer Pairs, Human HP100155
    info info
    添加购物车成功! 添加购物车失败!