Carboxypeptidase M cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Carboxypeptidase M cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Description
Full length Clone DNA of Mouse carboxypeptidase M.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Carboxypeptidase M cDNA ORF Clone, Mouse, untagged: Alternative Names

1110060I01Rik cDNA ORF Clone, Mouse; 5730456K23Rik cDNA ORF Clone, Mouse; AA589379 cDNA ORF Clone, Mouse; E030045M14Rik cDNA ORF Clone, Mouse

Carboxypeptidase M Background Information

Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.
Full Name
carboxypeptidase M
References
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait