After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CRABP2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_007759.2
Tamaño de cDNA:417bp
Descripción de cDNA:Full length Clone DNA of Mus musculus cellular retinoic acid binding protein II with N terminal HA tag.
Sinónimo de gen:Crabp-2, CrabpII, AI893628, Crabp2
Especie:Mouse
Vector:pCMV3-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50535-ACG$225
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50535-ACR$225
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50535-ANG$225
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50535-ANR$225
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50535-CF$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50535-CH$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50535-CM$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50535-CY$195
Ratón CRABP2 clonación del ADN o clonación génica(Vector de expresión)MG50535-M$75
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50535-NF$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50535-NH$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50535-NM$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50535-NY$195
Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación)MG50535-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

Referencias
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Catálogo: MG50535-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"