Pedido rápido

Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón CRABP2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_007759.2
    Tamaño de cDNA:417bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus cellular retinoic acid binding protein II with N terminal HA tag.
    Sinónimo de gen:Crabp-2, CrabpII, AI893628, Crabp2
    Especie:Mouse
    Vector:pCMV3-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CRABP2 qPCR primers for gene expression analysis, MP200527 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50535-ACG$225
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50535-ACR$225
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50535-ANG$225
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50535-ANR$225
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50535-CF$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50535-CH$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50535-CM$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50535-CY$195
    Ratón CRABP2 clonación del ADN o clonación génica(Vector de expresión)MG50535-M$75
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50535-NF$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50535-NH$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50535-NM$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50535-NY$195
    Ratón CRABP2 clonación del ADN o clonación génica(vector de clonación)MG50535-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

    Referencias
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Catálogo: MG50535-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"