Pedido rápido

Text Size:AAA

Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CRP Información de producto de clon de cDNA
Tamaño de cDNA:678bp
Descripción de cDNA:Full length Clone DNA of Mus musculus C-reactive protein, pentraxin-related with C terminal Flag tag.
Sinónimo de gen:AI255847, Crp
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50409-ACG$225
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50409-ACR$225
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50409-CF$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50409-CH$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50409-CM$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50409-CY$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(Vector de expresión)MG50409-M$75
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50409-NF$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50409-NH$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50409-NM$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50409-NY$195
Ratón C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación)MG50409-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Catálogo: MG50409-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.