After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Mouse CTSD ORF mammalian expression plasmid, N-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CTSD Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009983.2
Tamaño de cDNA:1233bp
Descripción de cDNA:Full length Clone DNA of Mus musculus cathepsin D with N terminal His tag.
Sinónimo de gen:CD, CatD, Ctsd
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fondo

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

Referencias
  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • Size / Price
    Catálogo: MG50127-NH
    Precio de lista:   (Save )
    Precio:      [How to order]
    Disponibilidad
     Instrucciones de envío
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"