GRO gamma cDNA ORF Clone, Mouse, untagged

Cat: MG50258-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GRO gamma Reagents

CRO Services

Product recommended


All GRO gamma Reagents

GRO gamma cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
303 bp
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRO gamma cDNA ORF Clone, Mouse, untagged Alternative Names

Dcip1 cDNA ORF Clone, Mouse;Gm1960 cDNA ORF Clone, Mouse

GRO gamma Background Information

CXCL3 is involved in migration, invasion, proliferation and tubule formation of trophoblasts and may play a key role in the pathogenesis of preeclampsia. CXCL3 autocrine/paracrine pathways are involved in the development of prostate cancer by regulating the expression of the target genes that are related to the progression of malignancies. CXCL3 is a novel adipokine that facilitates adipogenesis in an autocrine and/or a paracrine manner through induction of c/ebpb and c/ebpd. CXCL3 and its receptor CXCR2 are overexpressed in prostate cancer cells, prostate epithelial cells and prostate cancer tissues, which may play multiple roles in prostate cancer progression and metastasis.
Full Name
chemokine (C-X-C motif) ligand 3

GRO gamma cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRO gamma cDNA ORF Clone in Cloning Vector, Mouse MG50258-M
GRO gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50258-ACGLN
GRO gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50258-ACG
GRO gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50258-ACR
GRO gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50258-CF
GRO gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50258-NF
GRO gamma cDNA ORF Clone, Mouse, C-His tag MG50258-CH
GRO gamma cDNA ORF Clone, Mouse, N-His tag MG50258-NH
GRO gamma cDNA ORF Clone, Mouse, C-HA tag MG50258-CY
GRO gamma cDNA ORF Clone, Mouse, N-HA tag MG50258-NY
GRO gamma cDNA ORF Clone, Mouse, C-Myc tag MG50258-CM
GRO gamma cDNA ORF Clone, Mouse, N-Myc tag MG50258-NM
GRO gamma qPCR Primer Pairs, Mouse MP200284

GRO gamma cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRO gamma cDNA ORF Clone in Cloning Vector, Human HG12186-G
GRO gamma cDNA ORF Clone, Human, untagged HG12186-UT
GRO gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG12186-ACG
GRO gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12186-ACGLN
GRO gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG12186-ACR
GRO gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12186-CF
GRO gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12186-NF
GRO gamma cDNA ORF Clone, Human, C-His tag HG12186-CH
GRO gamma cDNA ORF Clone, Human, N-His tag HG12186-NH
GRO gamma cDNA ORF Clone, Human, C-HA tag HG12186-CY
GRO gamma cDNA ORF Clone, Human, N-HA tag HG12186-NY
GRO gamma cDNA ORF Clone, Human, C-Myc tag HG12186-CM
GRO gamma cDNA ORF Clone, Human, N-Myc tag HG12186-NM
GRO gamma qPCR Primer Pairs, Human HP101840
info info
添加购物车成功! 添加购物车失败!