After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse D6WSU163E Información de producto de clon de cDNA
Gene_bank_ref_id:NM_138594.3
Tamaño de cDNA:1659bp
Descripción de cDNA:Full length Clone DNA of Mus musculus DNA segment, Chr 6, Wayne State University 163, expressed.
Sinónimo de gen:C12orf4
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52454-ACG$245
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52454-ACR$245
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52454-ANG$245
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52454-ANR$245
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52454-CF$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52454-CH$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52454-CM$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52454-CY$215
Ratón D6WSU163E clonación del ADN o clonación génica(Vector de expresión)MG52454-G$75
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52454-NF$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52454-NH$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52454-NM$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52454-NY$215
Ratón D6WSU163E clonación del ADN o clonación génica(vector de clonación)MG52454-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52454-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"