Pedido rápido

Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón DAP3 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_022994.3
    Tamaño de cDNA:1191bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus death associated protein 3 with N terminal His tag.
    Sinónimo de gen:DAP-3; S29mt; MRP-S29; 4921514D13Rik
    Especie:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DAP3 qPCR primers for gene expression analysis, MP201291 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51407-ACG$225
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51407-ACR$225
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51407-ANG$225
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51407-ANR$225
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51407-CF$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51407-CH$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51407-CM$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51407-CY$195
    Mouse DAP3 Gene cDNA clone plasmidMG51407-G$75
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51407-NF$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51407-NH$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51407-NM$195
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51407-NY$195
    Ratón DAP3 clonación del ADN o clonación génica(Vector de expresión)MG51407-U$75
    Ratón DAP3 clonación del ADN o clonación génica(vector de clonación)MG51407-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51407-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"