After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse DCTN2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001190453.1
Tamaño de cDNA:1215bp
Descripción de cDNA:Full length Clone DNA of Mus musculus dynactin 2.
Sinónimo de gen:p50, RBP50, C87049, DCTN-50, GMP23-48K, 2310042E05Rik, C130077D06Rik
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52475-ACG$225
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52475-ACR$225
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52475-ANG$225
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52475-ANR$225
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52475-CF$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52475-CH$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52475-CM$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52475-CY$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(Vector de expresión)MG52475-G$75
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52475-NF$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52475-NH$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52475-NM$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52475-NY$195
Ratón Dynamitin/DCTN2 clonación del ADN o clonación génica(vector de clonación)MG52475-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52475-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"