After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón DDR2/CD167b clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse DDR2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_022563.2
Tamaño de cDNA:2565bp
Descripción de cDNA:Full length Clone DNA of Mus musculus discoidin domain receptor family, member 2 with N terminal HA tag.
Sinónimo de gen:Ntrkr3, tyro10, AW495251, Ddr2
Especie:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fondo

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

Referencias
et al.
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • Size / Price
    Catálogo: MG50541-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"