Pedido rápido

Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón DHCR24 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_053272.2
    Tamaño de cDNA:1551 bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus 24-dehydrocholesterol reductase
    Sinónimo de gen:2310076D10Rik,5830417J06Rik,mKIAA0018
    Especie:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DHCR24 qPCR primers for gene expression analysis, MP201606 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51733-ACG$245
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51733-ACR$245
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51733-ANG$245
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51733-ANR$245
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51733-CF$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51733-CH$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51733-CM$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51733-CY$215
    Mouse DHCR24 Gene cDNA clone plasmidMG51733-G$75
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51733-NF$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51733-NH$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51733-NM$215
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51733-NY$215
    Ratón Seladin 1 clonación del ADN o clonación génica(Vector de expresión)MG51733-U$75
    Ratón Seladin 1 clonación del ADN o clonación génica(vector de clonación)MG51733-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51733-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"