Pedido rápido

Text Size:AAA

Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse EDA2R Información de producto de clon de cDNA
Tamaño de cDNA:894bp
Descripción de cDNA:Full length Clone DNA of Mus musculus ectodysplasin A2 receptor transcript variant 2 with C terminal Flag tag.
Sinónimo de gen:Xedar, TNFRSF27, MGC124099, 9430060M22Rik, Eda2r
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50411-ACG$225
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50411-ACR$225
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50411-CF$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50411-CH$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50411-CM$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50411-CY$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)MG50411-M$75
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50411-NF$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50411-NH$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50411-NM$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50411-NY$195
Ratón XEDAR/EDA2R transcript variant 2 clonación del ADN o clonación génica(vector de clonación)MG50411-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type I II membrane protein. TNFRSF27 / EDA2R contains three TNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).

  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
  • Size / Price
    Catálogo: MG50411-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.