Pedido rápido

Text Size:AAA

Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse EIF4EBP1 Información de producto de clon de cDNA
Tamaño de cDNA:354bp
Descripción de cDNA:Full length Clone DNA of Mus musculus Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal His tag.
Sinónimo de gen:4e-bp1, PHAS-I
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50739-ACG$225
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50739-ACR$225
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50739-ANG$225
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50739-ANR$225
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50739-CF$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50739-CH$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50739-CM$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50739-CY$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(Vector de expresión)MG50739-G$75
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50739-NF$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50739-NH$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50739-NM$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50739-NY$195
Ratón 4E-BP1/EIF4EBP1 clonación del ADN o clonación génica(vector de clonación)MG50739-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    Catálogo: MG50739-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.