After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse EMC4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_026519.3
Tamaño de cDNA:552bp
Descripción de cDNA:Full length Clone DNA of Mus musculus ER membrane protein complex subunit 4.
Sinónimo de gen:Tmem85, 2610318K02Rik, RP23-336F11.33
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51379-ACG$225
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51379-ACR$225
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51379-ANG$225
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51379-ANR$225
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51379-CF$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51379-CH$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51379-CM$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51379-CY$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51379-NF$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51379-NH$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51379-NM$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51379-NY$195
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(Vector de expresión)MG51379-U$75
Ratón EMC4/TMEM85 clonación del ADN o clonación génica(vector de clonación)MG51379-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51379-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"