After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ENG Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001146348.1
Tamaño de cDNA:1959bp
Descripción de cDNA:Full length Clone DNA of Mus musculus endoglin, transcript variant 3 with C terminal Flag tag.
Sinónimo de gen:CD105, AI528660, AI662476, S-endoglin, Eng
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mENG-Flag
Sitio de restricción:KpnI + XbaI (6kb + 2kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ENG Gene Plasmid Map
Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50407-ACG$245
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50407-ACR$245
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50407-CF$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50407-CH$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50407-CM$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50407-CY$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(Vector de expresión)MG50407-M$75
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50407-NF$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50407-NH$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50407-NM$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50407-NY$215
Ratón Endoglin/CD105 transcript variant 3 clonación del ADN o clonación génica(vector de clonación)MG50407-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

Size / Price
Catálogo: MG50407-CF
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
  • Human SH2D1B ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"