After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Mouse ENTPD3 natural ORF mammalian expression plasmid

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ENTPD3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_178676.3
Tamaño de cDNA:1590bp
Descripción de cDNA:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 3.
Sinónimo de gen:HB6, Cd39l3, NTPDase-3, 6330566B20, Entpd3
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referencias
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • Size / Price
    Catálogo: MG50269-UT
    Precio de lista:   (Save )
    Precio:      [How to order]
    Disponibilidad2-3 weeksInstrucciones de envío
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"