Pedido rápido

Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón ENTPD5 Información de producto de clon de cDNA
    Tamaño de cDNA:1284bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 5 with C terminal His tag.
    Sinónimo de gen:Pcph, Cd39l4, mNTPase, AI196558, AI987697, NTPDase5, ER-UDPase, NTPDase-5, Entpd5
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with ENTPD5 qPCR primers for gene expression analysis, MP200470 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50473-ACG$225
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50473-ACR$225
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50473-ANG$225
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50473-ANR$225
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50473-CF$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50473-CH$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50473-CM$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50473-CY$195
    Ratón ENTPD5 clonación del ADN o clonación génica(Vector de expresión)MG50473-M$75
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50473-NF$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50473-NH$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50473-NM$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50473-NY$195
    Ratón ENTPD5 clonación del ADN o clonación génica(vector de clonación)MG50473-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Size / Price
    Catálogo: MG50473-CH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.