Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51960-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Epoxide hydrolase/EPHX1 Reagents

CRO Services

Product recommended


All Epoxide hydrolase/EPHX1 Reagents

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1368 bp
Description
Full length Clone DNA of Mouse epoxide hydrolase 1, microsomal with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI195553 cDNA ORF Clone, Mouse;Eph-1 cDNA ORF Clone, Mouse;Eph1 cDNA ORF Clone, Mouse;mEH cDNA ORF Clone, Mouse

Epoxide hydrolase/EPHX1 Background Information

Full Name
epoxide hydrolase 1, microsomal (xenobiotic)

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Epoxide hydrolase/EPHX1 cDNA ORF Clone in Cloning Vector, Rat RG80865-U
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, untagged RG80865-UT
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80865-ACG
Epoxide hydrolase/EPHX1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80865-ACGLN
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80865-ANG
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80865-ACR
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80865-ANR
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80865-CF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80865-NF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-His tag RG80865-CH
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-His tag RG80865-NH
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-HA tag RG80865-CY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-HA tag RG80865-NY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, C-Myc tag RG80865-CM
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Rat, N-Myc tag RG80865-NM
Epoxide hydrolase/EPHX1 qPCR Primer Pairs, Rat RP300829

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Epoxide hydrolase/EPHX1 cDNA ORF Clone in Cloning Vector, Mouse MG51960-G
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, untagged MG51960-UT
Epoxide hydrolase/EPHX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51960-ACGLN
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51960-ACG
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51960-ANG
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51960-ACR
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51960-ANR
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51960-CF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51960-NF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-His tag MG51960-CH
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-HA tag MG51960-CY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-HA tag MG51960-NY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, C-Myc tag MG51960-CM
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-Myc tag MG51960-NM
Epoxide hydrolase/EPHX1 qPCR Primer Pairs, Mouse MP201833

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Epoxide hydrolase/EPHX1 cDNA ORF Clone in Cloning Vector, Human HG14913-G
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, untagged HG14913-UT
Epoxide hydrolase/EPHX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14913-ACGLN
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14913-ACG
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14913-ACR
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14913-CF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14913-NF
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-His tag HG14913-CH
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, N-His tag HG14913-NH
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-HA tag HG14913-CY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, N-HA tag HG14913-NY
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, C-Myc tag HG14913-CM
Epoxide hydrolase/EPHX1 cDNA ORF Clone, Human, N-Myc tag HG14913-NM
Epoxide hydrolase/EPHX1 qPCR Primer Pairs, Human HP103542
info info
添加购物车成功! 添加购物车失败!