Her2 / ERBB2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50714-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Her2 / ERBB2 Reagents

CRO Services

Product recommended


All Her2 / ERBB2 Reagents

Her2 / ERBB2 cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+3.8kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Her2 / ERBB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Her2 / ERBB2 cDNA ORF Clone, Mouse, N-HA tag Validated Images

Human CNDP1 Gene Plasmid Map 5657

Her2 / ERBB2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names

c-erbB2 cDNA ORF Clone, Mouse;c-neu cDNA ORF Clone, Mouse;Erbb-2 cDNA ORF Clone, Mouse;HER-2 cDNA ORF Clone, Mouse;HER2 cDNA ORF Clone, Mouse;l11Jus8 cDNA ORF Clone, Mouse;mKIAA3023 cDNA ORF Clone, Mouse;Neu cDNA ORF Clone, Mouse

Her2 / ERBB2 Background Information

Epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD34, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy
Full Name
erb-b2 receptor tyrosine kinase 2
References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • Her2 / ERBB2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Her2 / ERBB2 cDNA ORF Clone in Cloning Vector, Rat RG80079-M
    Her2 / ERBB2 cDNA ORF Clone, Rat, untagged RG80079-UT
    Her2 / ERBB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80079-ACGLN
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80079-ACG
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80079-ACR
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80079-CF
    Her2 / ERBB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80079-NF
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-His tag RG80079-CH
    Her2 / ERBB2 cDNA ORF Clone, Rat, N-His tag RG80079-NH
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-HA tag RG80079-CY
    Her2 / ERBB2 cDNA ORF Clone, Rat, N-HA tag RG80079-NY
    Her2 / ERBB2 cDNA ORF Clone, Rat, C-Myc tag RG80079-CM
    Her2 / ERBB2 cDNA ORF Clone, Rat, N-Myc tag RG80079-NM
    Her2 / ERBB2 qPCR Primer Pairs, Rat RP300075

    Her2 / ERBB2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Her2 / ERBB2 cDNA ORF Clone in Cloning Vector, Mouse MG50714-G
    Her2 / ERBB2 cDNA ORF Clone, Mouse, untagged MG50714-UT
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50714-ACG
    Her2 / ERBB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50714-ACGLN
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50714-ACR
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50714-CF
    Her2 / ERBB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50714-NF
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-His tag MG50714-CH
    Her2 / ERBB2 cDNA ORF Clone, Mouse, N-His tag MG50714-NH
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-HA tag MG50714-CY
    Her2 / ERBB2 cDNA ORF Clone, Mouse, C-Myc tag MG50714-CM
    Her2 / ERBB2 cDNA ORF Clone, Mouse, N-Myc tag MG50714-NM
    Her2 / ERBB2 qPCR Primer Pairs, Mouse MP200689

    Her2 / ERBB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Her2 / ERBB2 cDNA ORF Clone in Cloning Vector, Human HG10004-M
    Her2 / ERBB2 cDNA ORF Clone, Human, untagged HG10004-UT
    Her2 / ERBB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10004-ACG
    Her2 / ERBB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10004-ACGLN
    Her2 / ERBB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10004-ACR
    Her2 / ERBB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10004-CF
    Her2 / ERBB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10004-NF
    Her2 / ERBB2 cDNA ORF Clone, Human, C-His tag HG10004-CH
    Her2 / ERBB2 cDNA ORF Clone, Human, N-His tag HG10004-NH
    Her2 / ERBB2 cDNA ORF Clone, Human, C-HA tag HG10004-CY
    Her2 / ERBB2 cDNA ORF Clone, Human, N-HA tag HG10004-NY
    Her2 / ERBB2 cDNA ORF Clone, Human, C-Myc tag HG10004-CM
    Her2 / ERBB2 cDNA ORF Clone, Human, N-Myc tag HG10004-NM
    Her2 / ERBB2 qPCR Primer Pairs, Human HP100074
    info info
    添加购物车成功! 添加购物车失败!