Pedido rápido

Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ERRFI1 Información de producto de clon de cDNA
Tamaño de cDNA:1386 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus ERBB receptor feedback inhibitor 1
Sinónimo de gen:1300002F13Rik,AI788755,Mig-6,Mig6,RALT
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51731-ACG$225
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51731-ACR$225
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51731-ANG$225
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51731-ANR$225
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51731-CF$75
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51731-CH$195
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51731-CM$195
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51731-CY$195
Mouse ERRFI1 Gene cDNA clone plasmidMG51731-G$75
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51731-NF$195
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51731-NH$195
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51731-NM$195
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51731-NY$195
Ratón ERRFI1 clonación del ADN o clonación génica(Vector de expresión)MG51731-U$75
Ratón ERRFI1 clonación del ADN o clonación génica(vector de clonación)MG51731-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51731-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.