After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse F10 Información de producto de clon de cDNA
Tamaño de cDNA:1446bp
Descripción de cDNA:Full length Clone DNA of Mus musculus coagulation factor X with C terminal Myc tag.
Sinónimo de gen:fX, Cf10, F10
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50363-ACG$225
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50363-ACR$225
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50363-CF$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50363-CH$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50363-CM$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50363-CY$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(Vector de expresión)MG50363-M$75
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50363-NF$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50363-NH$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50363-NM$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50363-NY$195
Ratón Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación)MG50363-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Catálogo: MG50363-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.