After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse F11R Información de producto de clon de cDNA
Gene_bank_ref_id:NM_172647.2
Tamaño de cDNA:903bp
Descripción de cDNA:Full length Clone DNA of Mus musculus F11 receptor with C terminal His tag.
Sinónimo de gen:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50463-ACG$225
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50463-ACR$225
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50463-CF$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50463-CH$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50463-CM$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50463-CY$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(Vector de expresión)MG50463-M$75
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50463-NF$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50463-NH$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50463-NM$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50463-NY$195
Ratón Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación)MG50463-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

Referencias
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catálogo: MG50463-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"