After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse F3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_010171.3
Tamaño de cDNA:885bp
Descripción de cDNA:Full length Clone DNA of Mus musculus coagulation factor III with C terminal Flag tag.
Sinónimo de gen:TF, Cf3, Cf-3, CD142, AA409063, F3
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50413-ACG$225
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50413-ACR$225
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50413-CF$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50413-CH$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50413-CM$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50413-CY$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(Vector de expresión)MG50413-M$75
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50413-NF$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50413-NH$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50413-NM$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50413-NY$195
Ratón Coagulation Factor III / Tissue Factor / CD142 clonación del ADN o clonación génica(vector de clonación)MG50413-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

Referencias
  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • Size / Price
    Catálogo: MG50413-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"