FABP4 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

FABP4 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Mouse fatty acid binding protein 4, adipocyte with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FABP4 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

422/aP2 cDNA ORF Clone, Mouse; ALBP/Ap2 cDNA ORF Clone, Mouse; Ap2 cDNA ORF Clone, Mouse; Lbpl cDNA ORF Clone, Mouse

FABP4 Background Information

Fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to thecalycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.
Full Name
fatty acid binding protein 4, adipocyte
References
  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait