After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse FAM126B Información de producto de clon de cDNA
Tamaño de cDNA:1761bp
Descripción de cDNA:Full length Clone DNA of Mus musculus family with sequence similarity 126, member B with N terminal His tag.
Sinónimo de gen:D1Ertd53e, D630010C10, C130065N10Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52548-ACG$245
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52548-ACR$245
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52548-ANG$245
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52548-ANR$245
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52548-CF$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52548-CH$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52548-CM$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52548-CY$215
Ratón FAM126B clonación del ADN o clonación génica(Vector de expresión)MG52548-G$75
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52548-NF$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52548-NH$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52548-NM$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52548-NY$215
Ratón FAM126B clonación del ADN o clonación génica(vector de clonación)MG52548-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52548-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.