Pedido rápido

Text Size:AAA

Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón FAM192A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_028221.4
    Tamaño de cDNA:765bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus family with sequence similarity 192, member A with N terminal His tag.
    Sinónimo de gen:Nip30; AI596259; 1700001O11Rik; 2310065K24Rik
    Especie:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FAM192A qPCR primers for gene expression analysis, MP201848 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51975-ACG$225
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51975-ACR$225
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51975-ANG$225
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51975-ANR$225
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51975-CF$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51975-CH$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51975-CM$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51975-CY$195
    Mouse FAM192A Gene cDNA clone plasmidMG51975-G$95
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51975-NF$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51975-NH$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51975-NM$195
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51975-NY$195
    Ratón NIP30 clonación del ADN o clonación génica(Vector de expresión)MG51975-U$75
    Ratón NIP30 clonación del ADN o clonación génica(vector de clonación)MG51975-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"