Pedido rápido

Text Size:AAA

Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse FAM43B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001081672.2
Tamaño de cDNA:993bp
Descripción de cDNA:Full length Clone DNA of Mus musculus family with sequence similarity 43, member B with C terminal His tag.
Sinónimo de gen:OTTMUSG00000009974
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51726-ACG$225
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51726-ACR$225
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51726-ANG$225
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51726-ANR$225
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51726-CF$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51726-CH$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51726-CM$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51726-CY$195
Ratón FAM43B clonación del ADN o clonación génica(Vector de expresión)MG51726-G$75
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51726-NF$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51726-NH$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51726-NM$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51726-NY$195
Ratón FAM43B clonación del ADN o clonación génica(vector de clonación)MG51726-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51726-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"