After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GLO1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_025374.3
Tamaño de cDNA:555bp
Descripción de cDNA:Full length Clone DNA of Mus musculus glyoxalase 1 with C terminal Myc tag.
Sinónimo de gen:GLY1, Qglo, Glo-1, Glo-1r, Glo-1s, Glo1-r, Glo1-s, AW550643, 0610009E22Rik, 1110008E19Rik, 2510049H23Rik, Glo1
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50364-ACG$225
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50364-ACR$225
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50364-ANG$225
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50364-ANR$225
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50364-CF$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50364-CH$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50364-CM$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50364-CY$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(Vector de expresión)MG50364-M$75
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50364-NF$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50364-NH$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50364-NM$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50364-NY$195
Ratón GLO1/Glyoxalase 1 clonación del ADN o clonación génica(vector de clonación)MG50364-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mouse Lactoylglutathione lyase, also known as Methylglyoxalase, Aldoketomutase, Glyoxalase I, Ketone-aldehyde mutase, S-D-lactoylglutathione methylglyoxal lyase and GLO1, is a member of the glyoxalase I family. GLO1 / Glyoxalase I is a ubiquitous cellular defense enzyme involved in the detoxification of methylglyoxal, a cytotoxic byproduct of glycolysis. Accumulative evidence suggests an important role of GLO1 expression in protection against methylglyoxal-dependent protein adduction and cellular damage associated with diabetes, cancer, and chronological aging. GLO1 / Glyoxalase I has been implicated in anxiety-like behavior in mice and in multiple psychiatric diseases in humans. GLO1 / Glyoxalase I catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. GLO1 / Glyoxalase I exists in three separable isoforms which originate from two alleles in the genome. These correspond to two homodimers and one heterodimer composed of two subunits showing different electrophoretic properties. GLO1 upregulation may play a functional role in glycolytic adaptations of cancer cells.

Referencias
  • Wu, YY. et al., 2008,Prog Neuropsychopharmacol Biol Psychiatry. 32 (7):1740-4.
  • Williams,R. et al., 2009, PLoS One  4 (3): e4649.
  • Antognelli,C. et al., 2009, BMC Cancer  9 :115.
  • Bair,W.B. et al., 2010, Melanoma Res  20 (2):85-96.
  • Size / Price
    Catálogo: MG50364-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"