After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GMPR Información de producto de clon de cDNA
Gene_bank_ref_id:NM_025508.4
Tamaño de cDNA:1038bp
Descripción de cDNA:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
Sinónimo de gen:AV028449, 2310004P21Rik
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51395-ACG$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51395-ACR$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51395-ANG$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51395-ANR$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51395-CF$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51395-CH$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51395-CM$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51395-CY$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51395-NF$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51395-NH$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51395-NM$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51395-NY$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(Vector de expresión)MG51395-U$75
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación)MG51395-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Catálogo: MG51395-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"