Pedido rápido

Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GMPR Información de producto de clon de cDNA
Tamaño de cDNA:1038bp
Descripción de cDNA:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
Sinónimo de gen:AV028449, 2310004P21Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51395-ACG$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51395-ACR$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51395-ANG$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51395-ANR$225
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51395-CF$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51395-CH$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51395-CM$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51395-CY$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51395-NF$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51395-NH$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51395-NM$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51395-NY$195
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(Vector de expresión)MG51395-U$75
Ratón GMPR / GMPR1 clonación del ADN o clonación génica(vector de clonación)MG51395-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Catálogo: MG51395-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.