After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón GP1BB/CD42c clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GP1BB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001001999.1
Tamaño de cDNA:645bp
Descripción de cDNA:Full length Clone DNA of Mus musculus glycoprotein Ib, beta polypeptide with N terminal Flag tag.
Sinónimo de gen:Gp1bb
Especie:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fondo

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

Referencias
  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.
  • Size / Price
    Catálogo: MG51075-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"