After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón GPA33 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GPA33 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_021610.1
Tamaño de cDNA:960bp
Descripción de cDNA:Full length Clone DNA of Mus musculus glycoprotein A33 (transmembrane) with N terminal HA tag.
Sinónimo de gen:BB116197, 2010310L10Rik, 2210401D16Rik, Gpa33
Especie:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fondo

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

Referencias
  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • Size / Price
    Catálogo: MG50559-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"