Pedido rápido

Text Size:AAA

Mouse GSTM2 ORF mammalian expression plasmid, C-Myc tag

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse GSTM2 Información de producto de clon de cDNA
Tamaño de cDNA:657bp
Descripción de cDNA:Full length Clone DNA of Mus musculus glutathione S-transferase, mu 2 with C terminal Myc tag.
Sinónimo de gen:Gstb2, Gstb-2
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Catálogo: MG52883-CM
    Precio de lista:   (Save )
    Precio:      [How to order]
     Instrucciones de envío
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.