Pedido rápido

Text Size:AAA

Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse H1F0 Información de producto de clon de cDNA
Tamaño de cDNA:585bp
Descripción de cDNA:Full length Clone DNA of Mus musculus H1 histone family, member 0 with C terminal Flag tag.
Sinónimo de gen:H1fv, H1(0), MGC19309, MGC98218, MGC117919, D130017D06Rik, H1f0
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51008-ACG$225
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51008-ACR$225
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51008-ANG$225
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51008-ANR$225
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51008-CF$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51008-CH$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51008-CM$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51008-CY$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(Vector de expresión)MG51008-G$75
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51008-NF$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51008-NH$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51008-NM$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51008-NY$195
Ratón H1F0/Histone H1 clonación del ADN o clonación génica(vector de clonación)MG51008-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 

  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.