Pedido rápido

Text Size:AAA

Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse HAPLN1 Información de producto de clon de cDNA
Tamaño de cDNA:1071bp
Descripción de cDNA:Full length Clone DNA of Mus musculus hyaluronan and proteoglycan link protein 1 with N terminal Flag tag.
Sinónimo de gen:LP, CLP, LP-1, Crtl1, Crtl1l, BB099155
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52939-ACG$225
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52939-ACR$225
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52939-ANG$225
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52939-ANR$225
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52939-CF$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52939-CH$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52939-CM$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52939-CY$195
Ratón HAPLN1 clonación del ADN o clonación génica(Vector de expresión)MG52939-G$75
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52939-NF$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52939-NH$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52939-NM$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52939-NY$195
Ratón HAPLN1 clonación del ADN o clonación génica(vector de clonación)MG52939-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

  • Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.
  • Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.
  • Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.
  • Size / Price
    Catálogo: MG52939-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.