Pedido rápido

Text Size:AAA

Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse HIST3H2A Información de producto de clon de cDNA
Tamaño de cDNA:393bp
Descripción de cDNA:Full length Clone DNA of Mus musculus histone cluster 3, H2a with C terminal Flag tag.
Sinónimo de gen:Hist3h2a
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51011-ACG$225
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51011-ACR$225
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51011-ANG$225
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51011-ANR$225
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51011-CF$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51011-CH$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51011-CM$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51011-CY$195
Ratón HIST3H2A clonación del ADN o clonación génica(Vector de expresión)MG51011-G$75
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51011-NF$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51011-NH$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51011-NM$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51011-NY$195
Ratón HIST3H2A clonación del ADN o clonación génica(vector de clonación)MG51011-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • Size / Price
    Catálogo: MG51011-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.