IFNA4 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50672-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IFNA4 Reagents

CRO Services

Product recommended


All IFNA4 Reagents

IFNA4 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
561 bp
Description
Full length Clone DNA of Mouse interferon alpha 4 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFNA4 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

Ifa4 cDNA ORF Clone, Mouse;MGC143607 cDNA ORF Clone, Mouse;RP23-139P14.30-001 cDNA ORF Clone, Mouse

IFNA4 Background Information

Interferon, alpha 4 (IFNA4) belongs to the alpha/beta interferon family. Two variants of IFNA4 (IFNA4a and IFNA4b) are known, which differ from each other by changes in their coding regions at nucleotide positions 22 and 41 and can be distinguished by selective restriction enzyme analysis. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.
Full Name
interferon, alpha 4
References
  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • IFNA4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IFNA4 cDNA ORF Clone in Cloning Vector, Rhesus CG90851-G
    IFNA4 cDNA ORF Clone, Rhesus, untagged CG90851-UT
    IFNA4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90851-ACG
    IFNA4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90851-ACGLN
    IFNA4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90851-ACR
    IFNA4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90851-CF
    IFNA4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90851-NF
    IFNA4 cDNA ORF Clone, Rhesus, C-His tag CG90851-CH
    IFNA4 cDNA ORF Clone, Rhesus, N-His tag CG90851-NH
    IFNA4 cDNA ORF Clone, Rhesus, C-HA tag CG90851-CY
    IFNA4 cDNA ORF Clone, Rhesus, N-HA tag CG90851-NY
    IFNA4 cDNA ORF Clone, Rhesus, C-Myc tag CG90851-CM
    IFNA4 cDNA ORF Clone, Rhesus, N-Myc tag CG90851-NM

    IFNA4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IFNA4 cDNA ORF Clone in Cloning Vector, Rat RG80173-G
    IFNA4 cDNA ORF Clone, Rat, untagged RG80173-UT
    IFNA4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80173-ACG
    IFNA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80173-ACGLN
    IFNA4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80173-ACR
    IFNA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80173-CF
    IFNA4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80173-NF
    IFNA4 cDNA ORF Clone, Rat, C-His tag RG80173-CH
    IFNA4 cDNA ORF Clone, Rat, N-His tag RG80173-NH
    IFNA4 cDNA ORF Clone, Rat, C-HA tag RG80173-CY
    IFNA4 cDNA ORF Clone, Rat, N-HA tag RG80173-NY
    IFNA4 cDNA ORF Clone, Rat, C-Myc tag RG80173-CM
    IFNA4 cDNA ORF Clone, Rat, N-Myc tag RG80173-NM
    IFNA4 qPCR Primer Pairs, Rat RP300166

    IFNA4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IFNA4 cDNA ORF Clone in Cloning Vector, Mouse MG50672-M
    IFNA4 cDNA ORF Clone, Mouse, untagged MG50672-UT
    IFNA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50672-ACG
    IFNA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50672-ACGLN
    IFNA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50672-ACR
    IFNA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50672-CF
    IFNA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50672-NF
    IFNA4 cDNA ORF Clone, Mouse, C-His tag MG50672-CH
    IFNA4 cDNA ORF Clone, Mouse, N-His tag MG50672-NH
    IFNA4 cDNA ORF Clone, Mouse, N-HA tag MG50672-NY
    IFNA4 cDNA ORF Clone, Mouse, C-Myc tag MG50672-CM
    IFNA4 cDNA ORF Clone, Mouse, N-Myc tag MG50672-NM
    IFNA4 qPCR Primer Pairs, Mouse MP200651

    IFNA4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IFNA4 cDNA ORF Clone in Cloning Vector, Human HG10336-M
    IFNA4 cDNA ORF Clone, Human, untagged HG10336-UT
    IFNA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10336-ACGLN
    IFNA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10336-ACG
    IFNA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10336-ACR
    IFNA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10336-CF
    IFNA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10336-NF
    IFNA4 cDNA ORF Clone, Human, C-His tag HG10336-CH
    IFNA4 cDNA ORF Clone, Human, N-His tag HG10336-NH
    IFNA4 cDNA ORF Clone, Human, C-HA tag HG10336-CY
    IFNA4 cDNA ORF Clone, Human, N-HA tag HG10336-NY
    IFNA4 cDNA ORF Clone, Human, C-Myc tag HG10336-CM
    IFNA4 cDNA ORF Clone, Human, N-Myc tag HG10336-NM
    IFNA4 qPCR Primer Pairs, Human HP100376
    info info
    添加购物车成功! 添加购物车失败!