Pedido rápido

Ratón IGFBP6 / IBP6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón IGFBP6 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_008344.3
    Tamaño de cDNA:717bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 6 with C terminal His tag.
    Sinónimo de gen:IGFBP-6, Igfbp6
    Especie:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IGFBP6 qPCR primers for gene expression analysis, MP200464 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fondo

    Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

    Referencias
  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • Size / Price
    Catálogo: MG50460-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"