IL-15 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50091-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IL-15 Reagents

CRO Services

Product recommended


All IL-15 Reagents

IL-15 cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 15 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.49kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-15 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-15 cDNA ORF Clone, Mouse, N-HA tag Validated Images

Rhesus CD3d/CD3 delta Gene Plasmid Map 5616

IL-15 cDNA ORF Clone, Mouse, N-HA tag Alternative Names

AI503618 cDNA ORF Clone, Mouse;IL-15 cDNA ORF Clone, Mouse

IL-15 Background Information

The protein encoded by IL15 gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported.Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy
Full Name
interleukin 15
References
  • Mongini PKA, Gupta R, Boyle E, et al. TLR-9 and IL-15 synergy promotes the in vitro clonal expansion of chronic lymphocytic leukemia B cells. Journal of immunology (Baltimore, Md : 1950). 2015;195(3):901-923.
  • IL-15 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-15 cDNA ORF Clone in Cloning Vector, Rhesus CG90115-G
    IL-15 cDNA ORF Clone, Rhesus, untagged CG90115-UT
    IL-15 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90115-ACGLN
    IL-15 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90115-ACG
    IL-15 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90115-ACR
    IL-15 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90115-CF
    IL-15 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90115-NF
    IL-15 cDNA ORF Clone, Rhesus, C-His tag CG90115-CH
    IL-15 cDNA ORF Clone, Rhesus, N-His tag CG90115-NH
    IL-15 cDNA ORF Clone, Rhesus, C-HA tag CG90115-CY
    IL-15 cDNA ORF Clone, Rhesus, N-HA tag CG90115-NY
    IL-15 cDNA ORF Clone, Rhesus, C-Myc tag CG90115-CM
    IL-15 cDNA ORF Clone, Rhesus, N-Myc tag CG90115-NM

    IL-15 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-15 cDNA ORF Clone in Cloning Vector, Rat RG80353-G
    IL-15 cDNA ORF Clone, Rat, untagged RG80353-UT
    IL-15 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80353-ACG
    IL-15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80353-ACGLN
    IL-15 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80353-ACR
    IL-15 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80353-CF
    IL-15 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80353-NF
    IL-15 cDNA ORF Clone, Rat, C-His tag RG80353-CH
    IL-15 cDNA ORF Clone, Rat, N-His tag RG80353-NH
    IL-15 cDNA ORF Clone, Rat, C-HA tag RG80353-CY
    IL-15 cDNA ORF Clone, Rat, N-HA tag RG80353-NY
    IL-15 cDNA ORF Clone, Rat, C-Myc tag RG80353-CM
    IL-15 cDNA ORF Clone, Rat, N-Myc tag RG80353-NM
    IL-15 qPCR Primer Pairs, Rat RP300323

    IL-15 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-15 cDNA ORF Clone in Cloning Vector, Mouse MG50091-M
    IL-15 cDNA ORF Clone, Mouse, untagged MG50091-UT
    IL-15 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50091-ACGLN
    IL-15 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50091-ACG
    IL-15 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50091-ACR
    IL-15 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50091-CF
    IL-15 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50091-NF
    IL-15 cDNA ORF Clone, Mouse, C-His tag MG50091-CH
    IL-15 cDNA ORF Clone, Mouse, N-His tag MG50091-NH
    IL-15 cDNA ORF Clone, Mouse, C-HA tag MG50091-CY
    IL-15 cDNA ORF Clone, Mouse, C-Myc tag MG50091-CM
    IL-15 cDNA ORF Clone, Mouse, N-Myc tag MG50091-NM
    IL-15 qPCR Primer Pairs, Mouse MP200121

    IL-15 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-15 cDNA ORF Clone in Cloning Vector, Human HG10360-M
    IL-15 cDNA ORF Clone, Human, untagged HG10360-UT
    IL-15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10360-ACGLN
    IL-15 cDNA ORF Clone, Human, C-GFPSpark® tag HG10360-ACG
    IL-15 cDNA ORF Clone, Human, C-OFPSpark® tag HG10360-ACR
    IL-15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10360-CF
    IL-15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10360-NF
    IL-15 cDNA ORF Clone, Human, C-His tag HG10360-CH
    IL-15 cDNA ORF Clone, Human, N-His tag HG10360-NH
    IL-15 cDNA ORF Clone, Human, C-HA tag HG10360-CY
    IL-15 cDNA ORF Clone, Human, N-HA tag HG10360-NY
    IL-15 cDNA ORF Clone, Human, C-Myc tag HG10360-CM
    IL-15 cDNA ORF Clone, Human, N-Myc tag HG10360-NM
    IL-15 qPCR Primer Pairs, Human HP100395
    info info
    添加购物车成功! 添加购物车失败!