Pedido rápido

Ratón IL1F10 / IL-38 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón IL1F10 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_153077.2
Tamaño de cDNA:504 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 1 family, member 10 with C terminal His tag.
Sinónimo de gen:RP23-176J12.7, IL1F10
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:pCMV3-mIL1F10-His
Sitio de restricción:KpnI + XbaI(6kb+0.5kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL1F10 qPCR primers for gene expression analysis, MP201179 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Flow cytometric analysis of Human IL17RA(CD217) expression on human whole blood granulocytes. Cells were stained with FITC-conjugated anti-Human IL17RA(CD217). The fluorescence histograms were derived from gated events with the forward and side light-scatter characteristics of viable granulocytes.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón IL1F10 / IL-38 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: MG51301-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"