After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón IL2/IL-2/Interleukin-2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse IL2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_008366.2
Tamaño de cDNA:510bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 2 with C terminal His tag.
Sinónimo de gen:IL-2
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón IL2/IL-2/Interleukin-2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Fondo

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

Referencias
  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
  • Size / Price
    Catálogo: MG51061-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"