Pedido rápido

Ratón IL-23/IL-23A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón IL23A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_031252.2
    Tamaño de cDNA:591bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 23, alpha subunit p19 with C terminal His tag.
    Sinónimo de gen:p19, IL-23
    Especie:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL23A qPCR primers for gene expression analysis, MP201044 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fondo

    IL-23, which is mainly secreted by antigen-presenting cells, is a member of the IL-12 family, which includes IL-12, IL-27, and IL-35[10]. IL-23 is a heterodimeric cytokine, comprised a unique p19 subunit and p40 subunit, the latter of which is shared with IL-12. The receptor for IL-23 consists of IL-23R and IL-12Rβ1, the latter of which is also characteristic of IL-12. IL-23 is essential for Th17 differentiation, expansion, and survival by binding to its receptor, thereby activating the signaling pathway [11,12]. Many studies revealed that the IL-23/Th17 pathway is implicated in the pathophysiology of various autoimmune diseases, such as autoimmune arthritis[13], primary biliary cirrhosis[14], and inflammatory bowel disease[15].

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Ye X, Zhang L, Wang H, et al. The Role of IL-23/Th17 Pathway in Patients with Primary Immune Thrombocytopenia. Kuwana M, ed. PLoS ONE. 2015;10(1):e0117704.
  • Size / Price
    Catálogo: MG51086-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"