Pedido rápido

Ratón IL-24/MDA-7 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse IL24 Información de producto de clon de cDNA
Tamaño de cDNA:546bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 24 with C terminal His tag.
Sinónimo de gen:FISP, Mda7, St16, Mda-7
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.