Pedido rápido

Ratón IL36B/IL1F8 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón IL36B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_027163.4
Tamaño de cDNA:552bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 1 family, member 8 with C terminal His tag.
Sinónimo de gen:2310043N20Rik
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL36B qPCR primers for gene expression analysis, MP201026 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fondo

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

Referencias
  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Catálogo: MG51071-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"